ID: 1092241555_1092241566

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1092241555 1092241566
Species Human (GRCh38) Human (GRCh38)
Location 12:6839201-6839223 12:6839236-6839258
Sequence CCCCGAGAAGGCTCACAGTCGGT CTGAGCTGACCCAGGGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36} {0: 1, 1: 0, 2: 3, 3: 46, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!