ID: 1092242451_1092242457

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1092242451 1092242457
Species Human (GRCh38) Human (GRCh38)
Location 12:6843547-6843569 12:6843564-6843586
Sequence CCCCTCCTGAGGGGTTCAGGGAA AGGGAACCCTGGGCTTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 195} {0: 1, 1: 0, 2: 0, 3: 31, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!