ID: 1092250902_1092250906

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1092250902 1092250906
Species Human (GRCh38) Human (GRCh38)
Location 12:6895855-6895877 12:6895885-6895907
Sequence CCCAAACTGCACTCCAGTTTGAG GCAAGACCCTGTCTCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 718} {0: 3, 1: 7, 2: 16, 3: 89, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!