|
Left Crispr |
Right Crispr |
| Crispr ID |
1092254513 |
1092254518 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:6918975-6918997
|
12:6919011-6919033
|
| Sequence |
CCGTCTCAAAAAAAAAAAAAAAA |
CTGGAGCCCTTGGGAATACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091} |
{0: 1, 1: 0, 2: 0, 3: 8, 4: 154} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|