ID: 1092256198_1092256205

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1092256198 1092256205
Species Human (GRCh38) Human (GRCh38)
Location 12:6927970-6927992 12:6927987-6928009
Sequence CCGAGGGGCCCGGGATCGCGCGG GCGCGGGTGCGGGCTGCGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 83} {0: 1, 1: 0, 2: 3, 3: 22, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!