ID: 1092256342_1092256348

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1092256342 1092256348
Species Human (GRCh38) Human (GRCh38)
Location 12:6928338-6928360 12:6928363-6928385
Sequence CCCGGAATCCCGCTCGGAGCCAG AGCCGTCCCGAGCTACCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102} {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!