ID: 1092256342_1092256356

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1092256342 1092256356
Species Human (GRCh38) Human (GRCh38)
Location 12:6928338-6928360 12:6928384-6928406
Sequence CCCGGAATCCCGCTCGGAGCCAG GGTAAGGTCTGCGGCCGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102} {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!