ID: 1092263779_1092263786

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1092263779 1092263786
Species Human (GRCh38) Human (GRCh38)
Location 12:6966006-6966028 12:6966038-6966060
Sequence CCTCCTTTGCTCCCAAGAGAAAA GGTTGACAGCCAGGAATCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 320} {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!