ID: 1092269534_1092269539

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1092269534 1092269539
Species Human (GRCh38) Human (GRCh38)
Location 12:7012291-7012313 12:7012319-7012341
Sequence CCAAGGGCATTTATCTTTTCCAG CATGCTCCTCCCAATCTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 235} {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!