ID: 1092276179_1092276182

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1092276179 1092276182
Species Human (GRCh38) Human (GRCh38)
Location 12:7062484-7062506 12:7062510-7062532
Sequence CCTGTTTTCACTTTTGGCATGGG ATGCTGAGCCTACCATGTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 179} {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!