ID: 1092276947_1092276951

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1092276947 1092276951
Species Human (GRCh38) Human (GRCh38)
Location 12:7068565-7068587 12:7068597-7068619
Sequence CCATGGGTGACTGGGAGTCACCT AACTGTAATCCTCTTGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191} {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!