ID: 1092282028_1092282030

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1092282028 1092282030
Species Human (GRCh38) Human (GRCh38)
Location 12:7105001-7105023 12:7105014-7105036
Sequence CCTGCCAAACAGTGAGCTGCATC GAGCTGCATCTCCCTCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106} {0: 1, 1: 0, 2: 2, 3: 20, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!