ID: 1092283097_1092283105

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1092283097 1092283105
Species Human (GRCh38) Human (GRCh38)
Location 12:7112223-7112245 12:7112247-7112269
Sequence CCCTTGTGCCAAAAAGGGTGGGG CTGCTGGTATAGAGGACAAGGGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 1130, 3: 1786, 4: 1453} {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!