ID: 1092292112_1092292123

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1092292112 1092292123
Species Human (GRCh38) Human (GRCh38)
Location 12:7166602-7166624 12:7166650-7166672
Sequence CCCTCCAGTCTCTGGAAAAATTG CCAAAAAGGTTGGTGACCACTGG
Strand - +
Off-target summary No data {0: 2, 1: 82, 2: 192, 3: 261, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!