ID: 1092295488_1092295491

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1092295488 1092295491
Species Human (GRCh38) Human (GRCh38)
Location 12:7194589-7194611 12:7194608-7194630
Sequence CCTTATTTTGTAATGGAATCCCC CCCCCCGTCTTAAATCTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184} {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!