ID: 1092297909_1092297914

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1092297909 1092297914
Species Human (GRCh38) Human (GRCh38)
Location 12:7216267-7216289 12:7216305-7216327
Sequence CCAAATTCCTTAAACACTCACAC CTACTCTTAAATAATGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 320} {0: 1, 1: 0, 2: 0, 3: 22, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!