ID: 1092301153_1092301158

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1092301153 1092301158
Species Human (GRCh38) Human (GRCh38)
Location 12:7251430-7251452 12:7251460-7251482
Sequence CCGACCAGCTTAAAAAACGGCGC ATTATATCCCGCACCTGGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!