|
Left Crispr |
Right Crispr |
| Crispr ID |
1092366484 |
1092366502 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:7881199-7881221
|
12:7881249-7881271
|
| Sequence |
CCCCCTGCTGCACTATGGGAGCC |
CAGCTCCCTCAGCTTGCGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 225, 3: 994, 4: 881} |
{0: 3, 1: 5, 2: 9, 3: 34, 4: 221} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|