ID: 1092370836_1092370841

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1092370836 1092370841
Species Human (GRCh38) Human (GRCh38)
Location 12:7915655-7915677 12:7915693-7915715
Sequence CCTAGAGCAATACAGAAAGGGCA CTGCATTGGAAGGCAGGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 236} {0: 1, 1: 0, 2: 2, 3: 17, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!