ID: 1092399547_1092399553

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1092399547 1092399553
Species Human (GRCh38) Human (GRCh38)
Location 12:8162643-8162665 12:8162686-8162708
Sequence CCCTATCTTCTCCCACGGAGAGC GGAGTCAAAGAAAGCCACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128} {0: 1, 1: 0, 2: 3, 3: 32, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!