ID: 1092426474_1092426481

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1092426474 1092426481
Species Human (GRCh38) Human (GRCh38)
Location 12:8379507-8379529 12:8379531-8379553
Sequence CCCCCAGGACACCAGGGTGCAGA TGGTGTGAGTAAAAGAGAGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 37, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!