ID: 1092427629_1092427632

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1092427629 1092427632
Species Human (GRCh38) Human (GRCh38)
Location 12:8387227-8387249 12:8387240-8387262
Sequence CCCTCCAGGAGGAGCTGTGGGTC GCTGTGGGTCAGACACACCCTGG
Strand - +
Off-target summary No data {0: 14, 1: 7, 2: 2, 3: 37, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!