ID: 1092428125_1092428131

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1092428125 1092428131
Species Human (GRCh38) Human (GRCh38)
Location 12:8390024-8390046 12:8390054-8390076
Sequence CCTTTTGGCTAGCTGCAGAGTCC CTCCCGGCCAGGGACGTCGTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 3, 3: 12, 4: 112} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!