ID: 1092435139_1092435146

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1092435139 1092435146
Species Human (GRCh38) Human (GRCh38)
Location 12:8441477-8441499 12:8441491-8441513
Sequence CCCCTTGTGATATGGTTTTTAAT GTTTTTAATATCCAGGGGGCTGG
Strand - +
Off-target summary {0: 22, 1: 29, 2: 95, 3: 437, 4: 1314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!