ID: 1092442028_1092442036

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1092442028 1092442036
Species Human (GRCh38) Human (GRCh38)
Location 12:8512870-8512892 12:8512913-8512935
Sequence CCCAAACTTTTGACCTCCAAATG GCTTCCACCAATGAATTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 198} {0: 1, 1: 1, 2: 24, 3: 304, 4: 1386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!