ID: 1092447034_1092447041

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1092447034 1092447041
Species Human (GRCh38) Human (GRCh38)
Location 12:8567518-8567540 12:8567558-8567580
Sequence CCCAAAATGTTACAGTGTCACTG TGCCTATGCAGACAAGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 201} {0: 1, 1: 0, 2: 1, 3: 13, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!