|
Left Crispr |
Right Crispr |
| Crispr ID |
1092455068 |
1092455077 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:8635911-8635933
|
12:8635955-8635977
|
| Sequence |
CCACTCCCTAATCTCAAGTACAC |
GGCCGCAGGGACCTCCGCCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 2110, 2: 540, 3: 380, 4: 1233} |
{0: 2, 1: 397, 2: 1688, 3: 798, 4: 320} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|