ID: 1092480904_1092480905

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1092480904 1092480905
Species Human (GRCh38) Human (GRCh38)
Location 12:8858262-8858284 12:8858284-8858306
Sequence CCTCAGTTTTCATGTCTGTAGAA ATGAGAATACAGATGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 87, 3: 657, 4: 3391} {0: 1, 1: 0, 2: 0, 3: 29, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!