|
Left Crispr |
Right Crispr |
| Crispr ID |
1092513610 |
1092513615 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:9184632-9184654
|
12:9184665-9184687
|
| Sequence |
CCTGCAAAGTGCTTTGGCTGACA |
AAGTGTTGTGACCAGTGGTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 7, 3: 37, 4: 192} |
{0: 1, 1: 3, 2: 31, 3: 54, 4: 180} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|