ID: 1092558921_1092558926

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1092558921 1092558926
Species Human (GRCh38) Human (GRCh38)
Location 12:9588871-9588893 12:9588899-9588921
Sequence CCACCATGTGAACAGCCTGGGAT GATGGAGAATTAGAAACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!