ID: 1092589778_1092589783

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1092589778 1092589783
Species Human (GRCh38) Human (GRCh38)
Location 12:9941787-9941809 12:9941836-9941858
Sequence CCTACAAATTGTTAAAATTAGAA GAGAATGAGCATGAGGAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 98, 4: 943}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!