ID: 1092591682_1092591686

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1092591682 1092591686
Species Human (GRCh38) Human (GRCh38)
Location 12:9957994-9958016 12:9958037-9958059
Sequence CCTCAAGGCTGCTCATGAAGAAG GAAAGTACCTCTGAGATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 234} {0: 1, 1: 8, 2: 13, 3: 51, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!