ID: 1092595840_1092595847

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1092595840 1092595847
Species Human (GRCh38) Human (GRCh38)
Location 12:10003965-10003987 12:10003998-10004020
Sequence CCACCCAGTGTGATTGAGGGAAA AAGGTGAAATGGGAGAGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 185} {0: 1, 1: 0, 2: 6, 3: 18, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!