ID: 1092609485_1092609486

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1092609485 1092609486
Species Human (GRCh38) Human (GRCh38)
Location 12:10156175-10156197 12:10156210-10156232
Sequence CCATACTTAGTGGTGCAACACTG TCAAGATCAATTTCAAAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 114} {0: 1, 1: 0, 2: 5, 3: 44, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!