ID: 1092611744_1092611752

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1092611744 1092611752
Species Human (GRCh38) Human (GRCh38)
Location 12:10180239-10180261 12:10180291-10180313
Sequence CCGTATGGCCCCCGTACAGAGTG TGCTAATAGAACAGTTAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35} {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!