ID: 1092615342_1092615353

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1092615342 1092615353
Species Human (GRCh38) Human (GRCh38)
Location 12:10211672-10211694 12:10211723-10211745
Sequence CCCTGTCGCTGCCCTACAGTACT AGGTGGGGAAATCCAGAACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65} {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!