ID: 1092632359_1092632366

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1092632359 1092632366
Species Human (GRCh38) Human (GRCh38)
Location 12:10395701-10395723 12:10395735-10395757
Sequence CCCTTGCCAGCTTATATGATAAA AAAGGCAGTGTGTAGTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 192} {0: 1, 1: 0, 2: 3, 3: 23, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!