ID: 1092658486_1092658488

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1092658486 1092658488
Species Human (GRCh38) Human (GRCh38)
Location 12:10713443-10713465 12:10713469-10713491
Sequence CCACTGTGATTTTAAAAACAGAT GGTTTTAAACAAAGTGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 450} {0: 1, 1: 0, 2: 3, 3: 11, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!