ID: 1092685125_1092685131

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1092685125 1092685131
Species Human (GRCh38) Human (GRCh38)
Location 12:11034625-11034647 12:11034661-11034683
Sequence CCTTTATTGGCCAGGCAGGGTAG TCCCAACATTTTGTAAGGCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 70, 4: 475} {0: 3, 1: 1, 2: 25, 3: 409, 4: 2813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!