ID: 1092685125_1092685133

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1092685125 1092685133
Species Human (GRCh38) Human (GRCh38)
Location 12:11034625-11034647 12:11034662-11034684
Sequence CCTTTATTGGCCAGGCAGGGTAG CCCAACATTTTGTAAGGCTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 70, 4: 475} {0: 4, 1: 46, 2: 1360, 3: 18658, 4: 130003}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!