ID: 1092712038_1092712041

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1092712038 1092712041
Species Human (GRCh38) Human (GRCh38)
Location 12:11349145-11349167 12:11349189-11349211
Sequence CCTCCTTTGGAAATATCCTATGC TTCCATCTTCTGTAATTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110} {0: 1, 1: 0, 2: 2, 3: 33, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!