ID: 1092712499_1092712516

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1092712499 1092712516
Species Human (GRCh38) Human (GRCh38)
Location 12:11353486-11353508 12:11353537-11353559
Sequence CCTTGTGGGGGTGGTCCTTGTGG TTCTTGCCTCCTTGTGGGGGTGG
Strand - +
Off-target summary {0: 26, 1: 19, 2: 7, 3: 17, 4: 192} {0: 1, 1: 8, 2: 16, 3: 40, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!