ID: 1092729272_1092729276

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1092729272 1092729276
Species Human (GRCh38) Human (GRCh38)
Location 12:11513005-11513027 12:11513042-11513064
Sequence CCAGTCTCAGTGAAGAAGGGTGT CCCAGAACACCACTCTCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 188} {0: 1, 1: 0, 2: 2, 3: 22, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!