ID: 1092736776_1092736783 |
View in Genome Browser |
Spacer: 24 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1092736776 | 1092736783 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 12:11590219-11590241 | 12:11590266-11590288 |
Sequence | CCCTTAATAATAAGGACTTTTCT | ATGGGAGAGAAGAATGAGGATGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 32, 3: 181, 4: 1153} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |