ID: 1092736776_1092736783

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1092736776 1092736783
Species Human (GRCh38) Human (GRCh38)
Location 12:11590219-11590241 12:11590266-11590288
Sequence CCCTTAATAATAAGGACTTTTCT ATGGGAGAGAAGAATGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 32, 3: 181, 4: 1153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!