|
Left Crispr |
Right Crispr |
| Crispr ID |
1092764709 |
1092764713 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:11842054-11842076
|
12:11842100-11842122
|
| Sequence |
CCTGGGCGACAGAGCGAGACTCC |
AAGAAGAAGGAGATGTAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20329, 1: 57869, 2: 114465, 3: 140937, 4: 148571} |
{0: 1, 1: 0, 2: 4, 3: 96, 4: 997} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|