ID: 1092766537_1092766538

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1092766537 1092766538
Species Human (GRCh38) Human (GRCh38)
Location 12:11858073-11858095 12:11858115-11858137
Sequence CCTCTGAGAGTGGCAGCAAGAGT ATCATAAAAAGCTCAGTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 224} {0: 1, 1: 0, 2: 2, 3: 21, 4: 267}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
19 12:11858073-11858095 CCTCTGAGAGTGGCAGCAAGAGT - 12:11858115-11858137 ATCATAAAAAGCTCAGTTTAAGG +