ID: 1092792773_1092792776

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1092792773 1092792776
Species Human (GRCh38) Human (GRCh38)
Location 12:12084189-12084211 12:12084206-12084228
Sequence CCTAAAATGATGGCCTCGCCTTG GCCTTGGCCTCCCAAAATGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 174} {0: 2796, 1: 62120, 2: 175684, 3: 221635, 4: 181490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!