ID: 1092795436_1092795441

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1092795436 1092795441
Species Human (GRCh38) Human (GRCh38)
Location 12:12106463-12106485 12:12106501-12106523
Sequence CCTTTTCCCATTTGGGGAGCCAG TTTTCAAAAGCAACTGTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 227} {0: 1, 1: 0, 2: 4, 3: 55, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!