ID: 1092795436_1092795442

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1092795436 1092795442
Species Human (GRCh38) Human (GRCh38)
Location 12:12106463-12106485 12:12106502-12106524
Sequence CCTTTTCCCATTTGGGGAGCCAG TTTCAAAAGCAACTGTATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 227} {0: 1, 1: 0, 2: 8, 3: 60, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!