ID: 1092796795_1092796799

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1092796795 1092796799
Species Human (GRCh38) Human (GRCh38)
Location 12:12119267-12119289 12:12119288-12119310
Sequence CCTTGCCCAAATTCTGAATCCTT TTTCTTCCACTGTTTTCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 28, 4: 294} {0: 2, 1: 1, 2: 8, 3: 86, 4: 753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!